face wash

Hej fooookks! Haha att jag och Ludwig har ett öppet förhållade är inte riktigt rätt.. Det blev lite fel med det hehe vi är tillsammans, bara vi. Vi är i ett vanligt förhållande! okokokokokokok? Jag kom i alla fall precis ut ur bastun. Jag satt där med Nelly och Hanna och vi försökte skvätta vatten i ansiktet och hålla ögenen öppna samtidigt som man ser supersnygg ut (som i alla facewash reklamer) och det funkade såådääääärr. Haha man ser mest ut som ett russin...






awesome

Heloooo lovers idag har varit en soft/seg dag, Det beror på hur man ser det. Men jag och Ludwig kom väl iväg till backen runt 1 hehe, sen har vi bara åkt runt lite osv osv haha alla vet väl hur man åker skidor eller snowboard. Jag har en 20-timmars uppsats att lämna in på SO:n också därför har jag inte oooorkaaaaaaatttt bloggaaaaa..... Seeeeeegt man. Jaja nu måste jag plugga lite till! Vi hörs sen!



zzzznööööö

Nej men tjeeenare mina älsklingar! Nu sitter jag här i fjällen helt död typ. Det är därför jag inte orakt bloggat för efter man har varit i backen hela dagen blir så sjukt trött när man kommer hem. Då är det bara skönt att ta en dusch, sätta på sig myskläder och kolla på en film. Men jag lovar att uppdatera mer! Vi hörs ikväll babbyyyyss



sådääär ja'

Just nu sitter jag och kollar mejlen och lyssnar på lugn musik. Vuxenpoäng KATSHIIING. Samtidigt som jag försöker växa upp lite försöker jag även förstå mig iMovie som jag inte rört innan idag. Jag fattar ingenting, suuuuck. Hur kan jag lära mig fatta iMovie? Jag får väl Googla. Haha jag har tänkt på att allt jag undrar frågar jag alltid er läsare om grejer. Mihihihihihi mycket billigare än att fråga 118 800! Ove Sundberg is in da house



KP brorsaaaaan

Hej kamrater! På tal om kamrat ska jag ta min syrras KP och läsa. Kamrat Posten hahah. Okeeej det där var inte ens kul men ajaa jag är lite konstig idag. Jag blir typ det om jag lämnas själv i ett hus och inte har någon att prata med så jag blir typ instängd med mina tankar. För jag vägrar att prata med mig själv!!?? Vem gör det liksom? Nu låter jag ju helt psykstörd haha men det är jag inte. Eller...?
KP is awesome! ↑Om inte min syrra hade premunierat (alla vet vad jag ill säga även om jag inte vet hur det stavas) Så hade jag lätt gjort det själv. All kärlek till kropp & knopp!



happy guuurl

Hahahaha vet ni vad jag alltid underhåller mig själv med? Sjunger med i låter jättehögt och ooootroooligt falskt! Jag tycker det är skitkul. Vilket roligt liv jag har, va? Haha det roligaste är att vara helt seriös men det funkar inte för jag börjar alltid skratta efter ca 5 sekunder. Ja, jag gör det här när jag är själv....  och ja, jag skrattar för mig själv också. Hello loner eller vadå?



ser ni avokadon gösta på bordet?

Hejsan bloggisen! Hittar ni Gösta? Jag klonade honom.. Kan ni gissa vad jag gör? Pluggar. Japp ni lästa rätt! Här sitter jag själv, när jag har hela huset för mig själv och kan i princip göra vad jag vill, och pluggar. Eller jaa nu har jag tagit en välförkänt (enligt mig) paus.
.
Hahaha jag vet inte varför jag har gått in på min egen blogg? Det var bara för att jag skulle ta kort och jag tycker det ser så fränt ut när man har sin egen blogg uppe. Typ som att göra reklam för sin blogg..... på sin blogg.... Kooorkat Herregud. Nää nu ska jag gå tillbaka till mitt häfte om konflikter, hotbilder och mänskliga rättigheter innan jag tappar fokus! Jag har inte direkt något fukos att tappa om vi nu ska vara sånna.



avicii

Snart är det Avicii. På fredag! HOW AWESOME! Jag är så stört taggad så det finns inte. Ni aaanar inte! Jag går typ seriöst runt och räknar timmar. Fast jag måste hämta min biljett vilket jag inte gjort än hehehe för imorgon åker jag bort och åker skidor (snowboard, men man säger ju åka skidor) Iiiiiiip! TAGGATAGGATAGGATAGGATAGGA!

-

LEVELS
-
Så vilka av er ska dit?



shoo qatter

Jag tänkte ta upp en sak nu på morgonkvisten som jag tänkt på. Morgonkvisten, klockan är ju halv två. Heliga Maria vad fort dagen går! Whatever vad jag tänkte säga är att jag har nämnligen aldrig förstått mig på är när bloggare lägger ut ett inägg med en fett snygg ''spontan'' bild och sen någon djup rubrik t.ex. ''kommer aldrig förlåta dig'' när det inte ens är riktat till någon utan dom bara skriver något som låter bra och lägger sedan in bilden. Va? Varför då liksom!? Haha är det bara jag som tycker det är jättetöntigt?
.
LOOK AT ME, I'M SO DEEP AND SPONTANEOUS! OR NAAAAAAAT. ↓
Hahahaha fan vilket dåligt exempel. But still. Fattar ni vad jag menar?
Har jag rätt/jätte fel? Älsklar att höra era åsikter kära vänner.



breakfast

Hej mina älsklingar! Miin älskling gick för ett tag sen för att han skulle på match. Så nu sitter jag här och har precis plockat undan allat från frukosten. Vi fick för oss att göra värsta satsarfrukosten. Jag kan få sånt där när jag är själv också, då börjar jag göra pannkakor, smoothies, toast, bacon och ägg till mig själv. Hur kan jag inte vara hungrig på morgonen när frulle är såååå gott!? It's awesome. Jag ska vara hemma själv nästan hela dagen så då kommer det bli jättebra update!



Q/A

Vart i stockholm bor du? asså Huddinge ,Täby osv..

Jag bor i Enskede.


Är du bara vän med såna som har märkeskläder?

Absolut inte! Jag skiter i vad mina kompisar har för kläder!


Vem är din bästa kompis, om du bara fick välja en.

Jag satt faktiskt och tänkte på det för någon dag sedan och kom fram till att det är min syrra, lääääätt! Jag säger allt till henne. Allt allt ALLT + att vi har exakt samma humor. Hon vet allt om mig och jag allt om henne. Jag älskar henne mer än något annat. Kompisar kommer och går men jag kommer alltid ha Hanna.


Vad ångrar du mest av allt?

Försöker att inte ångra saker


Skulle du vilja ha en mulberry väska eller chanel?

Mulberry utan tvekan!

 

Tycker dina föräldrar om att man tex köper kläder från Hollister, skor från Converse och stövlar från Hunters? eller gillar dom bäst kläder från H&M och skor från Skopunken?

Varför skulle dom inte tycka om det? Mina föräldrar älskar Converse och mamma tycker Hollister och A&F har jättefina grejer. Så länge det är snyggt så spelar det ingen roll. Därimot skiljer sig ju priset en del jag menar dom tycker ju faktiskt är ganska onödigt att ha 3 par Hunters när man kom köpa vilka gummistövlar som helst. För så speciella är ju dom inte + att det är fett mainstream och det kan jag hålla med om.

 

Läser du alla kommentarer?

Jag läser ALLA kommentarer, alltid!

 

Bor du i villa?

Jaaaaappp I do!

 

Varför vill du inte bli en barnstjärna?

För att det är svårt att tas på allvar sen när man faktiskt är vuxen.. Självklart finns det dom som lyckats men kolla bara på Amy Diamond liksom. Inget imot henne, hon är jätteduktig men hon är väl runt 20 nu?

 

Vilka är du med i skolan?

För det mesta är jag med Alex, Noel, Viktor, Lollo, Ludwig, Vilma, Theo, Sebbe, Nisse och Nicke. My homeboys! ↓

 

 

 

 







peace

Hello lovers. jag har världens bästa läsare! Om man vill mejla någon stillmall eller likande, kanske bara skriva något kan man göra det till → zara.larsson@yahoo.se så alla vet det. Idag har jag verkligen inte gjort ett skit! Skönt ju. Ikväll får vi se hur vi gör... Jag känner mig inte på topp så jag vet faktiskt om jag orkar åka till stan och träffa kompisar.



free

Hej mina babes! Idag är jag ledig, sköntsköntskönt. Mjaaa helt ledig är jag ju inte. Mamma tvingar mig städa mitt rum och helt ärligt kommer det nog ta större delen av dagen. Dels för att jag är så jävla seg när det kommer till tråkiga saker.. Fast jag tycker det är rätt kul att städa! Hur ska jag ha det? Haha jaja det måste ju göras, right? Vi hörs sen.



starships where meant to fly.

Cause i'm still hood, hollywood couldn't change me... - Moment 4 life Nicki Minaj.
Säga vad man vill om den meningen men ändrats har hon ju. Jag kommer ihåg när jag lyssnade på henne för 3 år sen typ. Aja den här låter kommer säkert spelas hööögt i sommar! STARSHIPS!



ny design

Något jag verkligen behöver är en ny design! Reeaalllyyyy. Jag har tröttnat något fruktansvärt på min. Kolla på den!!??? Jag vill ha en enkel och timeless. Någon snygg header med en snygg och propetionerlig stilmall! Min insperation till en ny design är nog Lotties amazing blogg eller Annas... LOOK AT THEM! Skulle någon snälla kunna göra en stilmall till mig eller säga vart snygga finns? Snelhest? I'll do anything.
KLICKA PÅ BILDERNA FÖR ATT KOMMA TILL DERAS BLOGGAR!
Lotties...
Annas...



hello lovers

Tre random bilder från dom senaste dagarna. Jag har blivit värsta träningsnarkomanen... It's awesome. Men helt ärligt så känns det sååå bra att träna. Idag blev det lite mys med Ammiii, Chloé, Paula och Malviz. Vi käka pizza och satte oss i Paulas källare och bara myste. Imorgon är det heeelg och loooov! Åhh jag är så taggad! Fast på lover måste jag göra ett arbete om 'Det globala samhället'. Häftet är ca 15 sidor man ska läsa, sen ska man svara på frågor, reflektera och ha med egnma åsikter osv osv osv osv. Det blir väl säkert braaaaa. Vi hööörs! Puss



hahahahahahaha epic fail




@zaralarsson instagram

Ni som inte följer mig får jättegärna göra det!! Jag heter zaralarsson där. Tyvärr jag gör inga shotouts eller följer dom jag inte känner men jag kollar in dom flesta och kanske likear några bilder! #follow #me #babes





run forrest, run!

Nu är jag tillbaka från min prao och sitter och äter pankakor! Life is awesome.. Senare ska jag antagligen gå och träna med Sebbe och kanske Ludwig men vi får se hur det blir med det. Om båda bangar så går jag ut och springer själv. Duktig tjej här! hihi
Forrest Gump är min favoritfilm of all times! helt klockers. Jag har någon sorts tvångstanke att varje gång någon springer (spelar ingen roll om jag känner personen) måste jag skrika RUN FORREST RUN!!! ni som inte har sett filmen fattar inte ett skit men då tycker jag att ni kan gå och se på den nuuuuuuu.



colors

Hello lovers! Paulinne tog upp en jätterolig grej på sin blogg. ↓ Nämnligen färger på alla veckodagar. Läs så förstår ni! Bilden är från hennes blogg.

-
Enligt mig håller jag inte alls med Palli! Måndag- röd tisdag- gul  onsdag- orange torsdag- mörkgrön fredag- ljusblå  lördag- vit  söndag- brun. Så nu ställer jag samma fråga som Paulinne, Vilken färg har ni på era dagar?



stockholms ....

Något jag tycker är både jättekul men samtidigt lite jobbigt är alla ''Stockholms katter, Stockholms vackraste, Sveriges finaste tjej/kille, snyggingar i Stockholm'' som finns på både Facebook och instagram! Jobbigt eftersom det bara kommer fler och fler och alla liknar ju varandra, roligt eftersom jag älskar att se mina kompisar bli ''veckans babe'' och det är ju roligast av allt att bli det själv. HISS/DISS?
Ni som inte bor i Stockholm - har ni sånt här?



prao

Hej mina änglar! Idag har jag chillat gaaalet på min prao. Jag har världens softaste prao! Just idag jobbade jag med två jättesnälla killar, Tommy och Mackan, på ett manegmentbolag som heter Ten. Jag fick spela in en låt som hette Wrap tror jag eller något sånt. Daayyymn vad den var bra! Helt ärligt så var den skitbra! Sen satt vi bara och snackade, lyssnade på musik osv. Igår praoade jag på Lugna favoriter med Niclas Wahlgren. Det var riktigt nice!
Dom här fick jag idaaag. Värt.



dark

Usch vad stökigt rum... Jag orkar inte bry mig helt ärligt. Jag ska gå och lägga mig för jag är jättetrött i alla fall! Vi hörs imorgon. Puss och natti natti ♥



american pancakes

Jag har kommit in i en period där jag äter american pancakes heeelaaa tiden. Min mamma börjar faktiskt bli ganska trött på det. Men helt seriöst, det är ju bland det godaste man kan äta? Ett + är ju att det är plättlätt och göra! Jag börjar verkligen få till dom! Dom blir perfekta! Nästa månad kommer jag ha någon ny favorit rätt men aajaaaa.



at the gym

Igår var jag och Linnéa och tränade! Jag har sån sjuk träningsvärk i magen och benen idag! Fast jag tycker det är nice att ha träningsvärk haha. Man känner sig så hurtig och duktg. Det var länge sedan jag tränade. Beach 2012 föööfaaan! Haha nej men jag tränar bara för att må bra och för att jag älskar känslan när man pressat sig så hårt så man mår illa.



måla gud

Hejsan bloggisen! Den här helgen har det inte hänt speciellt mycket, ändå har jag haft fullt upp. På lördag och igår var det konfaträff 10-15 så det var nästan hela dagen. Sedan på kvällen ville jag självklart träffa mina kompisar. Några klasskompisar kom hem till mig i förrgår och det slutade med att alla satt och snacka med min pappa. Pappa är tydligen otroligt intressant för mina killkompisar... Förstår inte varför för jag tycker bara han är pinsam! Men det är väl alla föräldrar - jobbiga och pinsamma! I still love him. På konfan fick vi måla en egen bild av Gud på en jättestor pappersduk med olika färger. Resultatet av det blev en skitful lila färg..



friday night

Hejsan my lovers! Vad gör ni en sån hr fredagskväll? Festar? Myser? Själv sitter jag i soffan och bara myser! Helt själv faktiskt... Snyft. Ludwig gick hem för ett tag sedan. Han var här hela dagen. Vi har gjort allt och inget typ haha. Jag vet att du läser min blogg Ludde Pudde Kurre så hej hej på dig! Jag gillar dig och tycker du är en rolig prick! Haha jag har tråååkigt! För alla som undrar är vi inte ihop. Fast jag gillar han jättejättemycket osv osv osv men vi är bara på g, än så länge hähähähäääää. Men aaa nu vet alla det, så slipper jag få frågor varje dag om det.




random

Jag kan bara göra 'det där med handen' (jag vet inte vad det heter, men när man särar två fingrar) med ena handen. Vilket stör mig något enormt. Jag sitter helt ärligt minst tre gånger om dagen och försöker med min andra hand. Liiiiiite resutat har det ju blivit! För jag kan ju faktiskt liiiiite med höger! Jag vet att det ser ut som om min dåliga hand är vänster, men det är bara för det är webcam och spegelvänt.
-
Har ni några skiilllzzzzz?



sjukhuset

Hej mina hjärtan! Idaag var en väldig soft dag. Jag skulle egentligen gjort mitt matteprov men jag missade sista lektionen (mattelektionen) för jag skulle iväg till farbror doktor och kolla min fossing. Fossing betyder fot enligt mig för alla som inte fattade det haha. Jag har typ en ärrbildning som gör ont. När jag var runt 5 opererade jag bort massa vävnad, ihoptrasslade blodkärl osv osv och nu har det börja göra ont igen. Osoooooftt! Jag fick göra magnetröntgen. Det tog ca en timme så jag somnade hehe.



vart tog självrespekten vägen?

Jag har tänkt på en sak...
-
Varför smuttsar tjejer ner sitt rykte eller bokstavligt stampar på sin självrespekt och lägger ut bilder med i princip iiinga kläder på bara för att få likes, kommentarer, uppmärksamhet eller läsare? Skulle aldrig i hela mitt liv sänka mig så lågt. Jag har självklart gjort dumma saker jag med men dom bilder man lägger ut kommer aldrig försvinna. Man kan få det svårt att skaffa ett seriöst jobb på grund av sånt.
.
Tror ni killarna kommer skryta om sin ''tjej'' när allmänheten får se hennes kropp lika mycket som hennes pojkvän får? Haha NEJ. Man serverar ju sig själv på en plasttalkrik. Inget silverfat, utan en billig jävla plasttallrik. Euw BIG DISSLIKE på sånt här. TJEJER SKÄRP ER NU FÖR FAN!! Eller kan någon förklara för mig varför man gör sånt? ....
.
Fast överallt ser man ju tjejer i bikinieklamer osv, Vad är det som är fel med det då? Om man står på stranden är det väl antagligen det man har på sig. Fast vad är anledningen till att sitta i underkläder hemma och posa? Sure att statestiken ökar men på vilken sida av skärmen sitter idioooten? Jag säger inte att det är rätt eller fel, försöker bara reflektera.



Ken ring - Varför blev du till en hora.
håller ni med mig?
Om inte, whyyyyy?



valentine

Hej mina älsklingar! Igår var det alla hjärtans dag. How cute! Den spenderades hemma hos Ludwig med han och Viktor. Vi bakade och hade allmäänt astrevligt och rrruuliigt yeey. Egentligen tycker jag alla ''traditioner'' är lite överskattade... men mysiga. Okej, jag måste erkänna att jag blev liiite trött på att halva Sverige skulle klaga över att dom inte hade någon jävla pojkvänn (för ja, det var bara tjejer som skulle tjata om det) Familjen och vännerna då? Haha jaja. Hoppas ni hade det kul iaf!



I'm a fucking loser

Hej bloggisen! Just nu sitter jag med Paulinne och bara pratar om allt möjligt som hänt. Haha Herregud vad det har hänt grejer! Mys juuuu. Senare ska jag plugga spanska eftersom vi har spanska prov på torsdag. Inte så trevligt.. Jag känner mig lite osocial mot Paulinne älsklipälskli. Haha mitt prov kommer faila så hårt. Blog you later! ♥
Spanskaprov here I come!



monday morning

Hej kära kamrater! Haha kamrater, vilket fult ord men aja hahahah. Åh, vad typiskt mig och påpeka att det var ett fult ord... Idag är det skola som vanligt. Haha jag vet inte riktigt vad jag vill ha sagt med det här inlägget. Ville nog bara upptadera osv osv!
Skjorta från Hollister och Jeans från Cheep Monday



soldag/sunday

Hejsan bloggisen och alla bloggisläsare! Idag har det ju verkligen varit en SOLDAG! ah ma gad vad fint väder! För mig har det även varit en ovaligt aktiv söndag! Först gick jag och lunchdejtade Andou. Det var väldigt trevligt eftersom jag inte sett henne på en evighet. Sen åkte vi två och köpte ett par HUNTERS på Sjutti på Shuttis (70% på Nathalie Schuterman, vääääärt) Jag visar dom imorgon!
.
Vid lunchtid hade jag lovat Chloé att komma hem till henne för att det är synd om henne, hon är sjuk. På vägen hem träffade jag Ludwig, Sebbe och Viktor. I fredags när jag sov hos Ludwig hade jag glömt min datorladdare (anledningen till varför jag inte bloggat idag) så dom kom och lämnade den! Snel hest va? Jag tvingade dom iaf at åka med til min statoin hehehe... Det var min daaaaag!





rest in peace 9/8 1963 - 11/2 2012

Med det utseendet och rösten var det otroligt synd att allt slutade i droger och bråk. Hoppas du får det bättre i himlen. Hela världen sörjer för dig. Whitney Houston, fan vad du är legend!
Tack för allt, we will always love you ♥




what to do?

Hej mina änglar! Ikväll får vi se om jag orkar masa mig in till stan.. Annars blir det bara hemmakväll med la familia, vilket är väldigt mysigt men jag vill såå gärna träffa kompisarna man bara kan träffa på helgen. Då måste jag fixa mig och massa.. Har lite beslustångest. Det blir säkert bra vad jag än gör. Vi hörs sen! Puss

Tumblr_l4898nwqi31qzcmcno1_500_large_large




Ludwig is in da house

Skulle publicerats igår.

Hej alla roliga människor där ute. Jag vet att ingen läser Zaras blogg för att den suger därför ska jag ta över den så att några börjar läsa den! HAHA idag var vi i skolan och mina homies frågade om jag och Zara var på g eller tillsammans. Men svaret på den frågan vet väl alla som följer Zara på instagram...

Zara: (med versler) JAG OCH LUDWIG ÄR INTE TILLSAMMANS OCH INTE PÅ G
Jag: Snyft...

(Jaaaaaaaaa vi är på g men jag skrev på instagram att vi inte var det.. av någon anledning hihihihihihihi/ Z)Hahaha men efter skolan drog vi till hennes gamla skola och träffade alla hennes förra klasskompisar. Tror jag fått tinitus efter den upplevelsen, Det vart ett jävla liv när Zara kom dit. ALLA, inte några, utan ALLA hennes tjejkompisar skrek i falsett. Jag, Alex och Erik visste inte om vi skulle skratta eller gråta. Sen efter det drog vi till Hammarbybacken och åkte snowboard. Det sög. Vi åkte kanske fyra åk sen satte vi oss och åt i värmestugan hehe. Efter ett tag kom min mamma och hämta oss för vi orkade inte släpa alla grejer hem. Nu sitter vi hos mig i ooorrtteeen bror och kollar på film haha. Herråååååååå










bilder från Funäsdalen




torsdag

Hello lovers! Idag börjar jag 12, hur soft!? Så jag ska snart börja dra mig mot skolan. Just nu sitter jag och lyssnar på Spotify. Det var inte alls längesen jag skaffade det! Herregud, hur har jag klarat mig? Jag kan slänga in en dagens senare ikväll men idag måste jag mest plugga inför matteprovet som vi har imorgon. Det är om samband vilket är väldigt lätt men jag vill ändå få bra resultat som ni säkert förstår.
Tack för att alla ni besserwissers rättar mig. Jag hade gjort exakt lika dant haha.



jag stör mig på

- Air max skor... Sorry, men I can't stand it.

- Folk med leopard tights, BIG NONO.

- När jag ringer folk och det är upptaget haha.

- När det är heelt knäpptyst och så börja någon tugga på något knaprigt eller hålla på och prassla med något haha. Man ba ''men driiver duuu?''

- FOLK SOM SÄGER DÅLIGARE! Jag är världensssss största Bessewisser och måste alltid rätta folk haha. Det heter sääämre.

- Folk som ska läsa över axeln på än när man sitter och läser en bok eller tidningen.

- När vissa ska slicka på sina fingrar innan dom ska vända blad på en tidning hahaha. Jag vet inte varför jag stör mig på det...

- När folk endast går på rykten om än och tror på allt som sägs....


Annars älskar jag allt och alla!!
Godnatt alla nattugglor där ute! Vi hörs imorgon.





king of hiphop

♥ EMINEM ♥



varje dag!




snökaoz

Tja bloggisen! Idag när vi vaknade var det -40! Herregud! Men man vänjer sig faktiskt ganka snabbt med kylan. Fast jag menar, kolla bara aftonbladet så står dte ju hur kallt det kommer bli. Det snöar i Maliis (Mallorca) liksom.. Hur sjukt är inte det på en skala!!?? Imorgon åker vi hem till min kära hemstad Stockholm. Saknar mina vänner och familj där nere. Jag har faktiskt blivit sjukt mycket på att åka bräda nu än innan! WEEHÅÅÅ!
.
Just nu sitter jag och snackar med Ludwig om allt möjligt i telefon, jättemysiiiigt haha jag älskar att prata i telefon. Jag har varit ganska osocial och jag skyller faktiskt allt på Ludwig, för jag har räknat ihop att vi har pratat i 8,5 timmar den här resan (!!???) Men daarliiings jag vill bara säga att ni är världens bästa läsare och era gulliga kommentarer gör mina dagar!
Jag som fotar mig själv som fotar mig själv i Hannas skidglasögon.
Tanjaaa!



första dagen i funäsdalen

Hej bloggisen! Nu har jag precis kommit hem från backen! Jag åker ju snowboard här med men jag märker verkligen hur mycket bättre jag är på skidor än snowboard. Haha aja, jag vill ju lära mig åka skiiiitbra på bräda så det är väl bara att kämpa påå. Nu ska vi snart gå ner och bada och basta, nice. Hörs sen mates ♥



true hahaha




Funäsdalen

Tjeeee bloggisen! Nu sitter jag på bussen på väg till Funäsdalen med dansgruppen. Jag sitter helt själv i ett litet hörn haha inte riktigt men jag är så trött så jag tänker ändå bara sova hela resan. Jag har datorn med mig så jag lovar att det kommer bli mycket uppdatering! Blir det bra? Bilder från skolan ↓
Homeboooyyyssss!
Jag och Ludwig hahahaha alla ni som följer PLL (pretty little liars) Förstår nog vem jag försöker se ut som..


här har vi dom liiiiiiiite coolare killarna!

Mysigt...

Weeehåååå!



Hej! Jag heter Zara och den här bloggen handlar om min vardag. Läs och kommentera!
RSS 2.0